ENCGM568GFA
Summary
- Status
- released
- Description
- This construct was made using the Human RP11 BAC library, derived from male whole blood, and contains a Localization and Affinity Purification (LAP) tag at the C-terminal of ZNF354B. The last 50 bases before the stop codon of ZNF354B are as follows: ATTATAAAATTCACATTGAAGAGGACTCCTTAAAAGCCGATTTGCATGTG
- Type
- insertion
- Tags
- eGFP — C-terminal
- Purpose
- tagging
Modification site
- Target
- ZNF354B-human
- Coordinates
- hg19 chr5:178165941-178337239
Modification method
- Nucleic acid delivery method
- stable transfection
- Reagents