ENCGM545OPP
Summary
- Status
- released
- Description
- This construct was made using the CHORI-17: Hydatidiform Mole (Homo sapiens) BAC Library and contains a Localization and Affinity Purification (LAP) tag at the C-terminal of PTRF. The last 50 bases before the stop codon of PTRF are as follows: AGATCACCGAGGAGTCGGACGCCGTGCTGGTGGACAAGAGCGACAGCGAC
- Type
- insertion
- Tags
- eGFP — C-terminal
- Purpose
- tagging
Modification site
- Target
- PTRF-human
Modification method
- Nucleic acid delivery method
- stable transfection
- Reagents