ENCGM224GHI

Summary

Status
released
Description
This construct was made using the Human RP11 BAC library, derived from male whole blood, and contains a Localization and Affinity Purification (LAP) tag at the C-terminal of NFE2L1. The last 50 bases before the stop codon of NFE2L1 are as follows: CCGACCAGCAGGCCCGGCGGCAGGAGAGGAAGCCAAAGGACCGGAGAAAG
Type
insertion
Tags
  • eGFPC-terminal
Purpose
tagging

Modification site

Coordinates
hg19 chr17:45995801-46223194

Modification method

Technique
stable transfection