ENCGM115KRH
Summary
- Status
- released
- Description
- This construct was made using the RPCI-11: Human Male BAC Library and contains a Localization and Affinity Purification (LAP) tag at the C-terminal of MAFG. The last 50 bases before the stop codon of MAFG are as follows: CCGCCACCAGCGTCATCACAATAGTAAAGTCCAAGACGGATGCCCGATCG
- Type
- insertion
- Tags
- eGFP — C-terminal
- Purpose
- tagging
Modification site
- Target
- MAFG-human
Modification method
- Nucleic acid delivery method
- stable transfection
- Reagents