ENCGM986VBH
Summary
- Status
- released
- Description
- This construct was made using the Invitrogen BAC (Bacterial Artificial Chromosome) Clone Collections and contains a N-terminal Localization and Affinity Purification (NFLAP) tag at the N-terminal of ELK1. The last 50 bases before the stop codon of ELK1 are as follows: GCTGTTTGCTCTCCAGGTACCCCTGGGATGGCGTGAGCACTCCCCCAGCG
- Type
- insertion
- Tags
- eGFP — N-terminal
- Purpose
- tagging
Modification site
- Target
- ELK1-human
- Coordinates
- hg19 chrX:10280201-10501645
Modification method
- Nucleic acid delivery method
- stable transfection
- Reagents