ENCGM950UUX
Summary
- Status
- released
- Description
- This construct was made using the Invitrogen BAC (Bacterial Artificial Chromosome) Clone Collections and contains a Localization and Affinity Purification (LAP) tag at the C-terminal of FOSL2. The last 50 bases before the stop codon of FOSL2 are as follows: GCGGGGACCAATCATCAGACTCCTTGAACTCCCCCACTCTGCTGGCTCTG
- Type
- insertion
- Tags
- eGFP — C-terminal
- Purpose
- tagging
Modification site
- Target
- FOSL2-human
- Coordinates
- hg19 chr2:28521943-28718325
Modification method
- Nucleic acid delivery method
- stable transfection
- Reagents