ENCGM803QAK

Summary

Status
released
Description
This construct was made using the CHORI-17: Hydatidiform Mole (Homo sapiens) BAC Library and contains a Localization and Affinity Purification (LAP) tag at the C-terminal of NFE2. The last 50 bases before the stop codon of NFE2 are as follows: ATGGGACCATCTTCCTTGTGCCCCGGGGGACCAAGATGGAGGCCACAGAC
Type
insertion
Tags
  • eGFPC-terminal
Purpose
tagging

Modification site

Modification method

Technique
stable transfection