ENCGM696LPO
Summary
- Status
- released
- Description
- This construct was made using the Invitrogen BAC (Bacterial Artificial Chromosome) Clone Collections and contains a Localization and Affinity Purification (LAP) tag at the C-terminal of NR4A1. The last 50 bases before the stop codon of NR4A1 are as follows: TGCCCCCTCCACCCATCATTGACAAGATCTTCATGGACACGCTGCCCTTC
- Type
- insertion
- Tags
- eGFP — C-terminal
- Purpose
- tagging
Modification site
- Target
- NR4A1-human
Modification method
- Nucleic acid delivery method
- stable transfection
- Reagents