ENCGM696LPO

Summary

Status
released
Description
This construct was made using the Invitrogen BAC (Bacterial Artificial Chromosome) Clone Collections and contains a Localization and Affinity Purification (LAP) tag at the C-terminal of NR4A1. The last 50 bases before the stop codon of NR4A1 are as follows: TGCCCCCTCCACCCATCATTGACAAGATCTTCATGGACACGCTGCCCTTC
Type
insertion
Tags
  • eGFPC-terminal
Purpose
tagging

Modification site

Modification method

Technique
stable transfection