ENCGM643PMJ
Summary
- Status
- released
- Description
- This construct was made using the Invitrogen BAC (Bacterial Artificial Chromosome) Clone Collections and contains a N-terminal FLAG, Localization and Affinity Purification (NFLAP) tag at the N-terminal of BACH1. The 50 bases before the tag are as follows: AATTAGAAGCATGCTTTCCACTGAACTTCCCGACAACATTTGTTATGCAGA
- Type
- insertion
- Tags
- eGFP — N-terminal
- Purpose
- tagging
Modification site
- Target
- BACH1-human
- Coordinates
- hg19 chr21:30648581-30798861
Modification method
- Nucleic acid delivery method
- stable transfection
- Reagents