ENCGM609KWB

Summary

Status
released
Description
This construct was made using the RPCI-11: Human Male BAC Library and contains a Localization and Affinity Purification (LAP) tag at the C-terminal of ATF1. The last 50 bases before the stop codon of ATF1 are as follows: TAATAGAAGAGTTAAAAACTTTGAAGGATCTTTATTCCAATAAAAGTGTT
Type
insertion
Tags
  • eGFPC-terminal
Purpose
tagging

Modification site

Modification method

Nucleic acid delivery method
stable transfection