ENCGM587QBW

Summary

Status
released
Description
The CETCh-seq method (Savic et al., 2015) was used to edit the genome of a pool of cells, inserting a 3xFLAG epitope at the 3' end of the target gene. The protein contains a C-terminal 3xFLAG tag.
Type
insertion
Tags
  • 3xFLAGC-terminal
Purpose
tagging

Modification site

Modification method

Technique
CRISPR
Guide RNAs
GCTCACAACAACATTAAACC

Documents

PCR analysis Characterization
Caption excerpt: DNA was extracted from 1 million HepG2_FLAG tagged cells for each…
Attachment from submitter
Lab
Richard Myers, HAIB