ENCGM475TQL

Summary

Status
released
Description
This construct was made using the CHORI-17: Hydatidiform Mole (Homo sapiens) BAC Library and contains a Localization and Affinity Purification (LAP) tag at the C-terminal of ELF1. The last 50 bases before the stop codon of ELF1 are as follows: CTTCTCAGGTAGCTATGAAACAAAACGAACTGCTGGAACCCAACTCTTTT
Type
insertion
Tags
  • eGFPC-terminal
Purpose
tagging

Modification site

Coordinates
hg19 chr13:41451804-41654738

Modification method

Technique
stable transfection