
This construct was made using the RPCI-11: Human Male BAC Library and contains a Localization and Affinity Purification (LAP) tag at the C-terminal of CREB3. The last 50 bases before the stop codon of CREB3 are as follows: GGCTTCCTACTGGTAGCCCCTCTGTCATTTTGCAGGACAGATACTCAGGC
  • eGFPC-terminal

Modification site

Modification method

Nucleic acid delivery method
stable transfection