ENCGM131CLR

Summary

Status
released
Description
This construct was made using the CHORI-17: Hydatidiform Mole (Homo sapiens) BAC Library and contains a Localization and Affinity Purification (LAP) tag at the C-terminal of ZNF644. The last 50 bases before the stop codon of ZNF644 are as follows: CCTCCATTACAGAAACTTCATTTTCTCTACTAATGGCCGAAGCAGCTTCA
Type
insertion
Tags
  • eGFPC-terminal
Purpose
tagging

Modification site

Coordinates
hg19 chr1:91368634-91583092

Modification method

Technique
stable transfection