ENCGM093KIV

Summary

Status
released
Description
This construct was made using the Human RP11 BAC library, derived from male whole blood, and contains a Localization and Affinity Purification (LAP) tag at the C-terminal of NR2C2. The last 50 bases before the stop codon of NR2C2 are as follows: TCAAGATGGAGACAGCAGAGTATAATGGCCAGATCACCGGAGCCAGTCTA
Type
insertion
Tags
  • eGFPC-terminal
Purpose
tagging

Modification site

Coordinates
hg19 chr3:14911275-15112240

Modification method

Technique
stable transfection