ENCGM007ITM

Alternate accession: ENCGM394IGX

Summary

Status
released
Description
CRISPR was used to insert a LAP tag downstream of the ZNF197 gene. The sequence of the guide RNA was CUGGAUGUGUCUGUUUCUCG.
Type
insertion
Tags
  • eGFPC-terminal
Purpose
tagging

Modification site

Modification method

Technique
CRISPR
Guide RNAs
CUGGAUGUGUCUGUUUCUCG